Femto-engineering for Dummies

femtobrain

Bored with nanotech already?

Sure, we don’t yet have Drexlerian molecular assemblers on our desks or Freitas-style medical nanobots coursing through our bodies – but the field of nanotech on the whole is truly underway. Most of contemporary nanotech is relatively unadventurous stuff about new materials and fabrics and so on, but some of it’s useful (longer-lasting batteries via nanotech?), and some is pushing in very interesting directions via fusing bio and nano (much as nanotech visionary Eric Drexler originally discussed in Engines of Creation).

If nanotech dreams have  lost some of their futuristic shine via the sin of too much practical realization, maybe it’s time for those of us who enjoy wild-eyed speculation to shift some of our attention on to femtotech?  My 2011 H+  Magazine article There’s Plenty More Room at the Bottom presented a case that femtotech is, at least, a reasonable thing to think about.

Of course there’s no real reason to stop at the femto scale — Hugo de Garis has talked about attotech and Planck-tech, and the search for “infra-particle intelligence.”   And there’s no strong reason to believe future physics will stop at the Planck scale — the cascade of X-techs may keep going further and further down. What if there is an infinitude of smaller scales; and as intelligences get smarter and smarter, they figure out how to make themselves smaller and smaller? Maybe once we port ourselves down to the femto-scale, we’ll recognize the existence of all the other femto-scale civilizations down there, and join them in their quest to port down to the Planck scale — from where we’ll join the other Planck-scale civilizations in their quest to port down even further.

(This could be viewed as a tweak on the “Transcension Hypothesis” solution to the Fermi Paradox, as discussed by John Smart, analyzed in depth by Clement Vidal, and discussed by me in a video interview on Critical Thought TV. The Transcension Hypothesis suggests that all the advanced alien civilizations have gone post-Singularity and disappeared into black holes in search of the maximal processing power that extreme compression brings. A quark star might be the refuge of choice for post-Singularity superminds that find blackholization forbidding yet still want the possibility of escape. Or maybe there are ways to structure plancktech or sub-plancktech into complex dynamic forms outside of exotic matter — instead, “beneath” ordinary matter. Maybe to find the post-Singularity superminds we just need to look within — deep, deep within; i.e. deep within our particles!)

But our understanding of Planck-scale physics is still pretty dim — it will be hard to say anything remotely solid about engineering at that level, even theoretically, till we finally unify quantum theory and general relativity theory. Our understanding of femto-scale physics is a least a bit more established — so we can muse about femto-engineering and femto-computing with a slightly lesser degree of wild-assedness (or should that be wild-assiduity?)

Anyway, I’ve been thinking a bit lately about how the construction of femtostructures might actually happen. So far the best ideas I’ve come up with seem possible only inside a quark-gluon plasma or maybe a quark star or some other kind of out-there form of strange matter. This means these ideas are only feasible under conditions of extreme temperature or density. No spacesuit is going to let us journey into a quark star — the density is such that the suit and our bodies would get mushed to an extent that even our atoms and their nuclei wouldn’t exist as such anymore.  Similarly, a quark-gluon plasma would fry any ordinary-matter visitor into a complex melange of sub-particulate strange matter, immediately upon entry.  On the other hand, if our minds reside in the pattern of organization and dynamics in our brains and bodies (as manifested in interaction with our environments), there’s no obvious reason these patterns couldn’t be ported into a quark star, as patterns of arrangement between quark structures rather than between cells made of molecules made of atoms. Then our minds and environments would effectively be running on virtual machines, implemented on quark structures of some sort.  (Sounds like a cool vacation to me, and maybe even a new home!)

But how might this actually work?  How could one actually build complex stuff using structures existent inside a quark star or quark-gluon plasma?

That’s exactly what I’m about to tell you!…. I’ll give a high-level recipe for building arbitrarily complex femtostructures inside quark matter, thus reducing the problem of femtotech to a few minor engineering challenges (ahem)….

But first I’ll review some important preliminary concepts…


Tensegrity

The notion of “tensegrity” was introduced by that unparalleled creative thinker of the last century, Buckminster Fuller. A tensegrity structure has a combination of compressed elements (e.g. sticks or other struts) and prestressed elements (like stretched-out strings). It holds itself together via the balance of forces in a net of continuous tension.

A few pictures of tensegrity structures will get the idea across better than a whole lot of words:


orig.Peter-Sandbichler-Tensegrity-Leuchtstoff-600x483
oct6vtri

Easy Landing by Snelson

 

There are decent arguments that tensegrity underlies the human body and its flexible balance and movement:


tensegrity
There’s lots of fascinating, relevant information on biotensegrity.com.

The idea of using tensegrity principles to design robot bodies appeals to me greatly, but I’ll leave that for another article.


Building Tensegrity Structures from DNA

You’ve probably heard of DNA origami — it’s cool but not as cool as “Self-assembly of three-dimensional prestressed tensegrity structures from DNA.”

Again, the following figures tell the story better than a whole lot of words. Basically, one can use DNA strands in place of struts and strings, and then build fairly familiar-looking tensegrity structures — but at the nano-scale. To make the analogue of struts, you just wrap a bunch of DNA strands around each other. It’s fairly simple and primitive, in a way — but it seems to work.

DNA)nano1

The above figure illustrates three-dimensional prestressed DNA tensegrity. Specifically:

a, Tensegrity prism constructed from wood and cord. b, Quasi-two-dimensional representation of the scaffold pathway through the prestressed tensegrity prism. The colour code indicates the nucleotide (nt) index along the circular path. Red represents the first nt on the 8,634-nt-long scaffold, violet the last nt. The three struts are labelled i, ii, iii. c, Three-dimensional representation of the scaffold pathway for the assembled prism. Staple strands are omitted for clarity. Light grey arrows denote the contractile forces exerted by the ssDNA springs, and dark grey arrows indicate the sum of compressive forces along the axis of the 13-helix bundle. d, Cylinder and scaffold models of an individual 13-helix bundle. Every cylinder represents one double helix. e, Electron micrographs and cylinder models of DNA tensegrity prisms. Scale bars, 20 nm.

The following figure illustrates how to generate force with DNA tensegrity objects, via exerting appropriate degrees of compressive force.

 

DNA)nano2

 

It shows how six-helix bundles under compression buckle if the compressive force exceeds a limit called the “critical Euler force.”  In detail:

a, Models of distorted tensegrity kites with 128-nm-long six-helix-bundle struts, three short ssDNA springs that are 273 nt long, and a long fourth spring that is 2,207 nt long. b, Profiles of the design of the struts, cylinder model and scaffold path representation. c, TEM images of gel-purified objects of the type shown in a. d, Model of a buckling kite with four springs of equal length (486 nt each, length adjusted with four six-helix-bundle clamps). e, TEM micrographs of gel-purified buckling kites. Scale bars, 20 nm.

Given today’s technology, building quite simple tensegrity structures out of DNA is a big job. But in principle, as the supporting technologies progress, one could build quite complex nanostructures this way.


Polymer Chains in Strange Matter

So much about the boring old nanoscale though — what about femto?

To really do femtotech properly, it seems, you may need to get out of the ordinary regime of matter, where quarks are locked up inside particles that are locked up inside nuclei. Fortunately there appear to be realms of “strange matter” where quarks are “asymptotically free” and can flexibly form a variety of complex structures, beyond the traditional groupings of quarks into particles. There are quark-gluon plasmas, which exist at very high temperatures; and quark stars, which exist at very high densities.

The following picture shows a visualization of one of the first full-energy collisions between gold ions at Brookhaven Lab’s Relativistic Heavy Ion Collider, as captured by the Solenoidal Tracker At RHIC (STAR) detector:


quarkgluonplasma
The following illustrates a quark star, and its difference in composition from a neutron star:

quark_star

But what happens inside these globs of strange matter? Is it just a uniform blur of quarks, or quarks and gluons, all smeared into each other? It seems not — it seems that depending on the particulars, you can get a lot more than that.

I’m particularly enchanted by a paper titled “Polymer Chains and Baryons in a Strongly Coupled Quark-Gluon Plasma” by Jinfeng Liao and Edward V. Shuryak.  What they show here is that one can, most likely, make long strands out of quarks inside a quark-gluon plasma.

To quote:

Recently there was a significant change of views on physical properties and underlying dynamics of Quark-Gluon Plasma at T=170−350MeV … instead of being a gas of q,g quasiparticles, a near-perfect liquid is observed. Also, precisely in this temperature interval, the interaction … is strong enough to support multiple binary bound states.

These multiple bound states are thought to include

(i) “polymer chains” of the type q¯gg..gq; (ii) baryons (qqq); (iii) closed (3-)chains of gluons (ggg).

And furthermore,

We point out that the presence of chains, or possibly even a chain network, may drastically change the transport properties of matter…

A chain network? Hmmm….

So far it’s unclear whether this kind of chain can exist inside a quark star.  But the physics of quark stars is still quite nascent, and there is certainly no reason to assume this kind of complexity wouldn’t be there.  It is clear from what we do know, that the internals of quark stars are considerably more complex than those of neutron stars.

 


Femto-engineering for Dummies

I suppose you’ve already figured out where I’m going with this.

If we can build stuff with genes, which are sequences of amino acids like

… AGCTTC TTTAAACACATTTGAGCAATATGATATGGCACTGATGCCT AGCCTGACATTTGGTCCTA GTTTAAAACTTAAAGCTGTCTTGGAATTTCGAT …

then why not also with chains of quarks and gluons like

q¯gg..gq

It seems entirely plausible — though certainly very far from demonstrated — that one can build tensegrity structures from quark or quark-gluon polymers, analogously to how it’s recently been done using DNA.

So, the path to femto-engineering just involves a few simple steps:

  1. Make a reasonably stable quark-gluon plasma; or make a quark star, or journey to one
  2. Fashion a device capable of reaching into said strange matter and manipulating the “polymer” chains therein
  3. Use said device to build tensegrity structures, by winding polymers around each other appropriately, and building structures of of the ensuing multi-polymer strands, in the broad fashion of DNA tensegrity structures

Easy as quark-gluon pie!

Eventually this will be viewed as a kindergarten exercise, somewhat like we now view fingerpainting or making little trays out of popsicle sticks.

Sure, given the current primitive state of the various supporting technologies, there are a few technical issues between here and the realization of this plan — such as the convincing demonstration that these strange-matter polymers actually exist … and the sustained creation of the high temperatures needed to support quark-gluon plasmas, or the creation of the high densities needed to make quark stars, or the journey to where quark stars already exist … and then the creation of appropriate tools for manipulating strange-matter polymers so we can shape them into tensegrity structures.

But I have great faith in human ingenuity, and even more in the ingenuity of our presumed robot inheritors. We can do it, folks! Building femto-scale machines, drug-stores, massage parlors, pets, virtual realities, virtual machines and mind uploading receptacles is our destiny! — or at least, one of the relatively nearby stops on the path to our unknowable longer-term destiny…

Also, even if the first femto-engineering happens in exotic matter conditions, this doesn’t mean femto-engineering will always have to stay there. Superconductiovity began restricted to the temperature domain near absolute zero — but then a few decades later the viability of room-temperature superconductivity was demonstrated. A few hours of experimenting with femto-engineering in a quark-gluon plasma may teach our super-fast-thinking robot descendants what it takes to do femto-engineering in traditionally human-friendly temperature and density regimes.

The mandate is clear – let’s get to work!  There’s plenty more room at the bottom!

 

8 Comments

  1. So how far is it to the nearest quark star? Maybe we need to think in terms of high energy accelerators to produce quarks and gluons. Throw in a catalyst to polymerize the quark-gluon chains.

  2. “wild-assedness (or should that be wild-assiduity?)”

    You sure can put the lol in philology.

  3. Very interesting and well thought out. As a typical ‘worst-case’ engineer a couple of questions – by what means would perception occur, as without it design and control would be rather difficult. Background “noise” (em, gravitational and probabilistic) might be at such a relative level as to make the probability of connectivities of any significant compexity having anything but a very short lifetime, very small indeed. Obviously, the solution is to have Meetings – many Meetings – on expenses.

  4. So is this the answer to the Fermi Paradox? Q: Where is everybody? A: Down at the quark level and continuing to dive…

    • I had the same thought when I read the section about the complexity of quark stars’ innards. What are those things, really? It might be wrong to view them as natural.

      If we follow that logic, then either we are late to the party, or civilizations typically skip the macro-scale expansion and go immediately to nanostructures and beyond… Don’t know if I buy that as a rule, but it’s a fascinating possibility.

  5. The concept of a continually diminishing scale is interesting. It is as interesting as the concept of an ever increasing scale and it is, of course, based on the fractal qualities of nature. I don’t believe however that it will be a never-ending process, but perhaps it will be a circular process.

    From ‘nothing’ came the Universe, then organic life, then technology, and then again ‘nothing’. Philosophically it makes sense, and I expect it will also make sense scientifically.

Leave a Reply